Ggra114.t1 (mRNA) Gracilaria gracilis GNS1m male

You are viewing an mRNA, more information available on the corresponding polypeptide page

Overview
NameGgra114.t1
Unique NameGgra114.t1
TypemRNA
OrganismGracilaria gracilis GNS1m male (Gracilaria gracilis GNS1m male (Slender Wart Weed))
Sequence length10
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
tig00000825_piloncontigtig00000825_pilon:8560..8665 -
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gracilaria gracilis GNS1m male OGS1.02022-05-09
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesTypePosition
Ggra114Ggra114Gracilaria gracilis GNS1m malegenetig00000825_pilon 8560..8665 -


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesTypePosition
Ggra114.t1Ggra114.t1Gracilaria gracilis GNS1m malepolypeptidetig00000825_pilon 8560..8665 -


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
Ggra114.t1.CDS1Ggra114.t1.CDS1Gracilaria gracilis GNS1m maleCDStig00000825_pilon 8560..8569 -
Ggra114.t1.CDS2Ggra114.t1.CDS2Gracilaria gracilis GNS1m maleCDStig00000825_pilon 8647..8665 -


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
Ggra114.t1.exon1Ggra114.t1.exon1Gracilaria gracilis GNS1m maleexontig00000825_pilon 8560..8569 -
Ggra114.t1.exon2Ggra114.t1.exon2Gracilaria gracilis GNS1m maleexontig00000825_pilon 8647..8665 -


The following intron feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
Ggra114.t1.intron1Ggra114.t1.intron1Gracilaria gracilis GNS1m maleintrontig00000825_pilon 8570..8646 -


The following start_codon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
Ggra114.t1.start1Ggra114.t1.start1Gracilaria gracilis GNS1m malestart_codontig00000825_pilon 8663..8665 -


Sequences
The following sequences are available for this feature:

mRNA sequence

>Ggra114.t1 ID=Ggra114.t1|Name=Ggra114.t1|organism=Gracilaria gracilis GNS1m male|type=mRNA|length=10bp
MYEFTPWSCX
back to top

spliced messenger RNA

>Ggra114.t1 ID=Ggra114.t1|Name=Ggra114.t1|organism=Gracilaria gracilis GNS1m male|type=mRNA|length=29bp|location=Sequence derived from alignment at tig00000825_pilon:8560..8665- (Gracilaria gracilis GNS1m male)|Notes=Excludes all bases but those of type(s): exon.  
ATGTACGAGTTTACTCCATGGAGCTGTGA
back to top

protein sequence of Ggra114.t1

>Ggra114.t1 ID=Ggra114.t1|Name=Ggra114.t1|organism=Gracilaria gracilis GNS1m male|type=polypeptide|length=10bp
MYEFTPWSCX
back to top

mRNA from alignment at tig00000825_pilon:8560..8665-

Legend: polypeptideCDSexonstart_codonintron
Hold the cursor over a type above to highlight its positions in the sequence below.
>Ggra114.t1 ID=Ggra114.t1|Name=Ggra114.t1|organism=Gracilaria gracilis GNS1m male|type=mRNA|length=106bp|location=Sequence derived from alignment at tig00000825_pilon:8560..8665- (Gracilaria gracilis GNS1m male)
ATGTACGAGTTTACTCCATGTAAGTCACCGCATTATGTACGCTACCTGGG
CTTTAGAAGAAGCGAAACGAGAGACTAACTGTTGTGATGTGAGCAGGGAG
CTGTGA
back to top

Coding sequence (CDS) from alignment at tig00000825_pilon:8560..8665-

>Ggra114.t1 ID=Ggra114.t1|Name=Ggra114.t1|organism=Gracilaria gracilis GNS1m male|type=CDS|length=29bp|location=Sequence derived from alignment at tig00000825_pilon:8560..8665- (Gracilaria gracilis GNS1m male)
ATGTACGAGTTTACTCCATGGAGCTGTGA
back to top