Ggra829.t1 (mRNA) Gracilaria gracilis GNS1m male

You are viewing an mRNA, more information available on the corresponding polypeptide page

Overview
NameGgra829.t1
Unique NameGgra829.t1
TypemRNA
OrganismGracilaria gracilis GNS1m male (Gracilaria gracilis GNS1m male (Slender Wart Weed))
Sequence length14
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
tig00000202_piloncontigtig00000202_pilon:356..526 +
Analyses
This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
Gracilaria gracilis GNS1m male OGS1.02022-05-09
Relationships

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesTypePosition
Ggra829Ggra829Gracilaria gracilis GNS1m malegenetig00000202_pilon 356..526 +


The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesTypePosition
Ggra829.t1Ggra829.t1Gracilaria gracilis GNS1m malepolypeptidetig00000202_pilon 356..526 +


The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
Ggra829.t1.CDS1Ggra829.t1.CDS1Gracilaria gracilis GNS1m maleCDStig00000202_pilon 356..381 +
Ggra829.t1.CDS2Ggra829.t1.CDS2Gracilaria gracilis GNS1m maleCDStig00000202_pilon 513..526 +


The following exon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
Ggra829.t1.exon1Ggra829.t1.exon1Gracilaria gracilis GNS1m maleexontig00000202_pilon 356..381 +
Ggra829.t1.exon2Ggra829.t1.exon2Gracilaria gracilis GNS1m maleexontig00000202_pilon 513..526 +


The following intron feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
Ggra829.t1.intron1Ggra829.t1.intron1Gracilaria gracilis GNS1m maleintrontig00000202_pilon 382..512 +


The following stop_codon feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesTypePosition
Ggra829.t1.stop1Ggra829.t1.stop1Gracilaria gracilis GNS1m malestop_codontig00000202_pilon 524..526 +


Sequences
The following sequences are available for this feature:

mRNA sequence

>Ggra829.t1 ID=Ggra829.t1|Name=Ggra829.t1|organism=Gracilaria gracilis GNS1m male|type=mRNA|length=14bp
XKPSPTSTTDGAK*
back to top

spliced messenger RNA

>Ggra829.t1 ID=Ggra829.t1|Name=Ggra829.t1|organism=Gracilaria gracilis GNS1m male|type=mRNA|length=40bp|location=Sequence derived from alignment at tig00000202_pilon:356..526+ (Gracilaria gracilis GNS1m male)|Notes=Excludes all bases but those of type(s): exon.  
CAAACCCTCGCCTACTTCAACCACAGacggagcgaaatga
back to top

protein sequence of Ggra829.t1

>Ggra829.t1 ID=Ggra829.t1|Name=Ggra829.t1|organism=Gracilaria gracilis GNS1m male|type=polypeptide|length=14bp
XKPSPTSTTDGAK*
back to top

mRNA from alignment at tig00000202_pilon:356..526+

Legend: polypeptideCDSexonintronstop_codon
Hold the cursor over a type above to highlight its positions in the sequence below.
>Ggra829.t1 ID=Ggra829.t1|Name=Ggra829.t1|organism=Gracilaria gracilis GNS1m male|type=mRNA|length=171bp|location=Sequence derived from alignment at tig00000202_pilon:356..526+ (Gracilaria gracilis GNS1m male)
CAAACCCTCGCCTACTTCAACCACAGGTAAGAGGGCTAACATTCTTACCC
GCTTTTGAAGCATTGTAATGCGCTCTCGGATGTATGTCAAAAGACTcact
tgcaactcgccttcacgtgatgtaccaacggtacctgtctcctccactct
tgcgtagacggagcgaaatga
back to top

Coding sequence (CDS) from alignment at tig00000202_pilon:356..526+

>Ggra829.t1 ID=Ggra829.t1|Name=Ggra829.t1|organism=Gracilaria gracilis GNS1m male|type=CDS|length=40bp|location=Sequence derived from alignment at tig00000202_pilon:356..526+ (Gracilaria gracilis GNS1m male)
CAAACCCTCGCCTACTTCAACCACAGacggagcgaaatga
back to top